ATS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Itano, H.
Right arrow Articles by Patterson, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itano, H.
Right arrow Articles by Patterson, G. A.
Related Collections
Right arrow Lung - transplantation

Ann Thorac Surg 2001;71:1126-1133
© 2001 The Society of Thoracic Surgeons

Original article: general thoracic

Endobronchial transfection of naked viral interleukin-10 gene in rat lung allotransplantation

Hideki Itano, MDa, Wanjiang Zhang, MDa, Jon H. Ritter, MDb, Timothy J. McCarthy, PhDc, Nelson S. Yew, PhDd, Thalachallour Mohanakumar, PhDa, G. Alexander Patterson, MDa

a Division of Cardiothoracic Surgery, Washington University School of Medicine, St. Louis, Missouri, USA
b Department of Pathology, Washington University School of Medicine, St. Louis, Missouri, USA
c Department of Radiology, Washington University School of Medicine, St. Louis, Missouri, USA
d Genzyme Corporation, Framingham, Massachusetts, USA

Address reprint requests to Dr Patterson, Division of Cardiothoracic Surgery, Washington University School of Medicine, 3108 Queeny Tower, One Barnes-Jewish Hospital Plaza, St. Louis, MO 63110
e-mail: kellym{at}msnotes.wustl.edu

Presented at the Poster Session of the Thirty-sixth Annual Meeting of The Society of Thoracic Surgeons, Fort Lauderdale, FL, Jan 31–Feb 2, 2000.


   Abstract
Top
 Footnotes
 Abstract
Introduction
 Material and methods
 Results
 Comment
 Acknowledgments
 References
 
Background. Recent studies suggest that viral interleukin-10 (vIL-10) suppresses alloimmune response in transplantation. Tissue mRNA expression of inducible nitric oxide synthase (iNOS) and exhaled nitric oxide (NO) levels have been observed to increase in lung allograft rejection. The aims of this study were to examine the feasibility of vIL-10 gene transfer into rat lung allografts and to investigate its effect on subsequent allograft rejection.

Methods. Male Lewis rats (RT1l) underwent left lung transplantation with allografts from Brown Norway rats (RT1n). The donor rats were endobronchially transfected 2 minutes before harvest with 400 µg (group I, n = 5), 600 µg (group II, n = 5), or 800 µg (group III, n = 5) of naked pCMVievIL-10. Group IV (n = 5) animals, serving as control, received 400 µg of naked pCF1-CAT. All recipients were sacrificed on postoperative day 5. Transgene expression of vIL-10 was assessed by both reverse transcriptase-polymerase chain reaction and immunohistochemistry. Allograft gas exchange, exhaled NO level, histologic rejection score, and mRNA expression of graft cyokines were also assessed.

Results. Transgene expression of lung graft vIL-10 was detected by both reverse transcriptase-polymerase chain reaction and immunohistochemistry. The iNOS mRNA expression in groups I, II, and III was significantly lower than that of group IV (p < 0.05, analysis of variance). Exhaled NO levels in groups I, II, and III were significantly lower than in group IV (p < 0.01, analysis of variance). There was no significant difference between groups with respect to gas exchange, peak airway pressure, or histologic rejection score.

Conclusions. It appears that endobronchial transfection of naked vIL-10 plasmid in a rat lung allotransplant model is feasible and suppresses lung iNOS mRNA expression and exhaled NO levels. An association between iNOS upregulation and high exhaled NO levels in lung allograft resection was also noted.


   Introduction
Top
 Footnotes
 Abstract
 Introduction
Material and methods
 Results
 Comment
 Acknowledgments
 References
 
Lung transplantation has evolved into an effective therapeutic option in the management of patients with end-stage pulmonary diseases [1]. However, allograft rejection remains a serious impediment to the clinical success of lung transplantation. Gene transfer, the temporary introduction of genes to organs that results in transient gene expression and production of a functional gene product to modify tissue responses, might be an effective strategy to decrease transplant rejection. Ex vivo gene delivery to grafts before implantation might offer a specific method for achieving graft-targeted, sustained, endogenous production of therapeutic gene products, while at the same time minimizing possible unwanted systemic side effects from exposure to the transgene product of nontargeted organs. Gene transfer of immunosuppressive cytokine genes to the allograft may be a viable local immunosuppressive strategy, by markedly impairing effective antigen presentation, reducing or eliminating antigenicity, and preventing rejection or prolonging graft survival while avoiding the systemic toxicity of conventional immunosuppressive therapy.

Interleukin-10 (IL-10) is produced by macrophages and Th2 cells. It inhibits the synthesis of cytokines by Th1 cells activated by monocyte/macrophage antigen-presenting cells [2]. It has been shown that IL-10 inhibits monocyte/macrophage-dependent T-cell activation and antigen-presenting cell function [3, 4], as well as suppress alloreactivity in vivo [5]. Because of these effects, it has been suggested that IL-10 might be useful in the treatment of transplant rejection. Stimulatory effects of IL-10, however, have also been observed on both T- and B-cell differentiation, including enhancing major histocompatibility complex class II expression [6, 7]. Viral interleukin-10 (vIL-10), a product encoded by the Epstein-Barr virus BCRF1 open reading frame, is homologous to cellular IL-10, especially in the coding region of the mature protein sequence [8]. It shares many biological properties with cellular IL-10, including cytokine synthesis inhibitory factor activity and downregulation of class II major histocompatibility complex expression on monocytes. Viral IL-10, however, does not possess the T-cell costimulatory activities of cellular IL-10 [9], which suggests that vIL-10 may be a more potent immunosuppressant molecule.

The central hypothesis of the current study was that graft vIL-10 gene transfer and overexpression within lung allografts may influence the subsequent rejection in a major histocompatibility complex-mismatched strain combination.


   Material and methods
Top
 Footnotes
 Abstract
 Introduction
 Material and methods
Results
 Comment
 Acknowledgments
 References
 
Plasmids
The plasmid pCMVievIL-10 was kindly provided by Genzyme Corporation (Framingham, MA). This plasmid was constructed to encode the immunosuppressive cytokine vIL-10 under the control of the human cytomegalovirus (CMV) immediate early promoter in the sense orientation. The plasmid pCF1-CAT (Genzyme Corporation) consists of the human CMV immediate early gene promoter/enhancer, chloramphenicol acetyltransferase (CAT) cDNA, as previously described [10]. The sequence of vIL-10 was confirmed by DNA sequencing before using 377 DNA Sequencer (PE Applied Biosynthesis, Foster City, CA).

In vitro bioassay of pCMVievIL-10
The in vitro functional assay was performed to test the bioactivity of pCMVievIL-10, based on the ability of IL-10 to inhibit the synthesis of interferon (INF)-{gamma} by PHA-P-stimulated human peripheral blood mononuclear cells (PBMC) as reported by Hsu and colleagues [8]. Human PBMCs were isolated from buffy coats of healthy donors by centrifugation over Ficoll-Hypaque and cultured at 106 per milliliter with varying amounts of supernatant of COS-7 cell culture, which were transfected with pCMVievIL-10 using LipofectAMINE (Life Technology, Gaithersburg, MD) 72 hours before PBMC culture. The human PBMCs were cultured for 5 days in RPMI 1640-10 (10% fetal bovine serum) complete medium with PHA-P (10 µg/mL), and neutralizing monoclonal antibody to TGF-fl (10 µg/mL) pan-specific anti-TGF-fl antibody (Sigma, St. Louis, MO). Cultures were performed in triplicate in 96-well plates, 200 µL per well. Human IFN-{gamma} level was determined by an enzyme-linked immunosorbent assay kit (Quantikine Human IFN-gamma Immunoassay, R&D Systems, Minneapolis, MN).

Animals
Male inbred Brown Norway and Lewis rats, weighing 250 to 320 g, were obtained from Harlan Sprague-Dawley (Indianapolis, IN). All animal procedures have been approved by the Animal Study Committee of Washington University. Animals received humane care in compliance with the "Guideline for the Care and Use of Laboratory Animals" published by the National Institutes of Health (National Institutes of Health publication 85-23, revised 1985).

Study design, gene transfer, and transplantation
Animals were divided into four groups. Transfection was accomplished with 400 µg (group I; n = 5), 600 µg (group II; n = 5), 800 µg (group III; n = 5) of pCMVievIL-10. Group IV (n = 5) rats, serving as control, received 400 µg of pCF1-CAT. The naked plasmid diluted into 100 µL of saline was instilled into the left main bronchus of the anesthetized donors in a left decubitus position through a 14-gauge venous cannula tracheostomy, with the right main bronchus ligated. After 2 minutes of mechanical ventilation, donor rat pulmonary arteries were flushed with 20 mL of cold (4°C) low potassium dextran 1% glucose (LPDG) solution after systemic heparinization. Heart–lung blocks were immediately excised en bloc and stored in LPDG solution at 4°C for 1 hour. Left lung allografts were then orthotopically transplanted by means of a modification of the previously described "cuff technique" [11].

Assessment
Recipient animals underwent median sternotomy on postoperative day 5. After the ligation of right main bronchus and pulmonary artery, allografts were ventilated with 100% oxygen, 1.5 mL of tidal volume, at a rate of 100 breaths/min. Peak airway pressures were measured, and exhaled gas was collected for 3 minutes. After 5 minutes of graft ventilation, arterial blood samples were obtained for blood gas analysis. Recipients were then sacrificed and left lung allografts were immediately flushed with 20 mL of cold saline solution. The lower half of the lung graft was frozen in liquid nitrogen and stored at -80°C for reverse transcriptase-polymerase chain reaction (RT-PCR) assessment. The upper half of the grafts was fixed with Histochoice fixative (AMRESCO, Solon, OH) flushed through the trachea with 20 cm H2O for histologic assessment. The sections were stained with hematoxylin and eosin, and examined by a blinded pathologist (JHR). The sections were graded separately for both acute vascular rejection and airway rejection based on the revised working formulation as described elsewhere [12].

RNA isolation and cDNA synthesis
Total lung RNA was prepared by guanidine isothiocyanate extraction with RNeasy Mini (QIAGEN Inc, Valencia, CA), following the manufacturer’s instructions. Extracted RNA was quantified by a spectrophotometer Spectronic Genesys 5 (Spectronic Instruments, Inc, Rochester, NY). Each 1 µg of extracted RNA sample was reverse-transcribed at room temperature for 10 min, 42°C for 15 minutes, 99°C for 5 minutes, 5°C for 5 minutes in a total of 20-µL reaction mixture; 5 mmol/L MgCl2, 50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3, 1 mmol/L of each deoxynucleotide-triphosphate (dNTP), 1 µL RNase Inhibitor, 2.5 U/µL cloned murine leukemia virus reverse transcriptase, and 2.5 µmol/L oligo d(T)16 (Perkin Elmer, Foster City, CA).

Semiquantitative polymerase chain reaction
To investigate the influence of vIL-10 transfection on allograft cytokine alteration, semiquantitative RT-PCR for transgene vIL-10 and several cytokines was performed. Reverse transcribed cDNA was amplified by PCR with 0.02 to 0.03 U/µL Hot StarTaq Polymerase (QIAGEN Inc.) on a Mastercycler gradient (Eppendorf Scientific, Hamburg, Germany) in a 33-µL reaction: 3.0 µL of RT product, 1.5 mmol/L MgCl2, 200 µmol/L of each dNTP, and 0.3 to 0.5 µmol/L of each primer, PCR buffer (QIAGEN Inc.) including KCl, Tris-HCl (NH4)2SO4, after the first step of 95 °C for 17 minutes, 25 to 35 cycles of 95°C for 30 seconds, 58°C (annealing temperature varying for different primers for 30 seconds, and 72°C for 1 minute, followed by a final incubation at 72°C for 10 minutes. The sequence of primer pairs was designed for glyceraldehyde-3-phosphate dehydrogenase (sense: 5'- CATGACCACAGTCCATGCCATCAC; antisense: 5'-CATGTAGGCCATGAGGTCCACCAC-3', 472 bp), vIL-10 (sense: 5'-ATGGAGCGAAGGTTAGTGGTC-3'; antisense; 5'-CCTGGCTTTAATTGTCATGTATG-3', 510 bp), inducible nitric oxide synthase (iNOS) (sense: 5'-GCCTCCCTCTGGAAAGA-3'; antisense: 5'-TCCATGCAGACAACCTT-3', 500 bp), INF-{gamma} (sense: GTTACTGCCAAGGCACACTCATTGAAAGCC-3'; antisense: 5'-TCAGCACCGACTCCTTTTCCGCTTCCTTAGGC-3', 413 bp), intracellular adhesion molecule [ICAM-1] (sense: 5'-TTCCTGCCTCGGGGTGGATCCG-3'; antisense: 5'-AGAGCTGTGTCC-GCGGTGCTCC-3', 331 bp), IL-2 (sense: 5'-TGCCTGGAAAATGAACTCGG-3'; antisense: 5'-CTGGCTCATCATCGAATTGG-3', 166 bp), and IL-10 (sense: 5'-TGCCTTCAGTCAAGTGAAGAC-3'; antisense: 5'-AAACTCATTCATGGCCTTGTA-3', 346 bp). PCR cycles and annealing temperature were calibrated for each primer pair. The glyceraldehyde-3-phosphate dehydrogenase bands were used to calibrate PCR input at unsaturated amplification for semiquantification. Polymerase chain reaction products were electrophoresed on a 0.8% agarose gel and visualized by ethidium bromide staining. The gel images were stored using the Gel Documentation System Image Store 7500, version 7.12 (UVP Inc, Upland, CA) under ultraviolet transilluminator. The average optical density of bands was quantitated by the GelBase/GelBlot-Pro Version 3.10 (Syngene/Synoptics Ltd, Frederick, MD).

Immunohistochemistry for vIL-10
Paraffin-embedded lung allograft sections were mounted on glass slides, and permeabilized for cytokine localization by incubation of the slides in 0.1% saponin/0.2% Triton X-100/TBS (100 mmol/L Tris, 500 mmol/L NaCl, pH 7.4) supplemented with 0.1% saponin and 0.2% Triton X-100 according to R&D System’s protocol for cytokine localization. This buffer was used for all washings. After deparaffinization, slides were steam-treated in a citrate buffer Target Retrieval Solution (DAKO, Carpinteria, CA) for 35 minutes at 95°C. After blocking endogenous peroxidase with 3% H2O2/PBS for 15 minutes, slides were incubated in an Fc receptor blocker (Accurate Chemical & Scientific Corp., Westbury, NY), and Super Block Buffer (PIERCE, Rockford, IL) including 10% normal goat serum and 1% bovine serum albumin. The immunohistochemistry procedure was performed with Tyramide Signal Amplification kit (TSA-Indirect, NEN Life Science Products, Boston, MA), following the manufacturer’s instructions. Briefly, after treatment with TNB blocking buffer in TBS, the slides were incubated overnight at room temperature with 1:25 diluted biotinylated rat antiviral IL-10 monoclonal antibody (Pharmingen, San Diego, CA). After incubation with streptavidin–horseradish peroxidase for 30 minutes at room temperature, the slides were incubated in biotinyl tyramide solution for 20 minutes at room temperature. Following subsequent washes in TBS/Triton X-100/saponin, the slides were incubated with streptavidin–alkaline phosphatase for 30 minutes at room temperature. Color reaction was developed by a BCIP/NBT alkaline phosphatase substrate kit (Vector Laboratories, Inc, Burlingame, CA) including 5 mmol/L levamisole. After 10 to 20 minutes, the reaction field was blocked by washing in TE buffer (10 mmol/L Tris, pH 8.0, 1 mmol/L EDTA), counterstained with nuclear fast red, and permanently mounted with Cytoseal 60 (Stephens Scientific, Kalamazoo, MI).

Exhaled nitric oxide analysis
Nitric oxide (NO) levels in allograft exhaled gas were measured by a Sievers 280 nitric oxide analyzer (Sievers Instruments, Inc, Boulder, CO) within 30 minutes of collection. Emissions from electronically excited nitrogen dioxide were detected in a gas-phase chemiluminescent reaction between NO and ozone. The sensitivity of the measurement is less than 1 ppb. At every measurement, it was confirmed that the baseline NO level of 100% O2 was 0 ppb. Exhaled NO from normal left lung of Brown Norway rats (n = 5) was also measured in the same way as in other study groups.

Statistical analysis
Data were analyzed by one-way analysis of variance (ANOVA) and Fisher’s posthoc multiple comparison test. Data not normally distributed was transformed with a square root transformation before performing the ANOVA. Nonparametric data were analyzed by Kruskal-Wallis test and Mann-Whitney test with Bonferroni correction. A p value of less than 0.05 was considered statistically significant.


   Results
Top
 Footnotes
 Abstract
 Introduction
 Material and methods
 Results
Comment
 Acknowledgments
 References
 
The total number of rat lung transplant procedures that were performed to achieve 20 5-day survivals was 25, and the mortality of the experimental animals was 20.0%.

Bioassay of pCMVievIL-10
The in vitro vIL-10 functional assay was performed to test whether pCMVievIL-10 transfection yields bioactive IL-10 protein, based on the ability of IL-10 to inhibit the synthesis of INF-{gamma} by PHA-P-stimulated human PBMC. IFN-{gamma} levels (mean, picograms per milliliter ± standard deviation) in the human PMBC culture with 1% (95.3 ± 15.7 pg/mL), 5% (52.3 ± 8.62 pg/mL), and 10% (55.3 ± 29.4 pg/mL) of COS-7-vIL-10 transfection supernatants were significantly lower than with mock-10% supernatants (295.0 ± 75.0 pg/mL) (p = 0.0002, p < 0.0001, and p < 0.0001, respectively, by ANOVA) (Fig 1). This result indicates that pCMVievIL-10 transfection can yield bioactive vIL-10 protein. Human PBMC culture without PHA-P stimulation did not yield detectable IFN-{gamma}.



View larger version (25K):
[in this window]
[in a new window]
  		Fig 1. Bioassay of pCMVievIL-10. Synthesis of interferon (INF)-{gamma} by human PBMCs cultured with varying amounts of 3-day COS-7-vIL-10 transfection supernatants and PHA-P was compared. Interferon-{gamma} levels (in picogram per milliliter) in the human PBMC culture with 1%, 5%, and 10% of COS-7-vIL-10 transfection supernatants were significantly lower than mock 10% supernatants (*p < 0.001 versus mock 10%, analysis of variance). Results are shown as the mean ± standard deviation of three cultures per group.

 
Semiquantitative RT-PCR for transgene vIL-10 and cytokines
To confirm allograft pCMVievIL-10 transfection at transcriptional levels, semiquantitative RT-PCR for vIL-10 was performed. Although intensity of the vIL-10 band was variable from sample to sample, vIL-10 transgene mRNA expression in lung grafts was detected in all samples of groups I, II, and III (Fig 2A). The iNOS (mean relative units ± SD) in lung grafts in groups I (0.651 ± 0.37), II (0.538 ± 0.52), and III (0.991 ± 0.41) was significantly lower than group IV (1.780 ± 0.41) (p = 0.0033, p = 0.0004, and p = 0.0273, respectively, ANOVA), whereas normal lung iNOS expression (0.046 ± 0.05; n = 5) was significantly lower than all other groups (Fig 2B). This indicates that iNOS mRNA expression level is minimal in normal lung and remarkably upregulated in allograft rejection. The upregulation is significantly downregulated by vIL-10 transfection. Normal lung mRNA expression of INF-{gamma} and endogenous IL-10 was significantly lower than all other groups (p < 0.05, p < 0.005, respectively, ANOVA). There were no significant differences between groups in IL-2 and ICAM-1 mRNA expression levels.



View larger version (28K):
[in this window]
[in a new window]
  		Fig 2. (A) Reverse transcriptase-polymerase chain reaction analysis of vIL-10 mRNA transgene expression in rat lung allografts. The Glyceraldehyde-3-phosphate dehydrogenase (GA3PDH) mRNA expression in lung allografts served as internal control and was used to calibrate polymerase chain reaction input for semiquantification. Average optical density of bands was expressed as a relative ratio of vIL-10/glyceraldehyde-3-phosphate dehydrogenase. There were no significant differences between groups. Values are mean ± standard deviation of five animals per group. (PC = polymerase chain.) (B) Reverse transcriptase-polymerase chain reaction analysis of inducible nitric oxide synthase (iNOS) mRNA expression in rat lung allografts. Average optical density of bands was expressed as relative ratio of inducible nitric oxide synthase/glyceraldehyde-3-phosphate dehydrogenase. Inducible nitric oxide synthase mRNA expression in groups I, II, and III were significantly lower than group IV (*p < 0.05 versus group IV, analysis of variance). Inducible nitric oxide synthase mRNA expression in normal lung (NL) was significantly lower than all other groups (**p < 0.05, analysis of variance). Values are mean ± standard deviation of five animals per group.

 
Immunohistochemistry for transgene vIL-10
To confirm allograft pCMVievIL-10 transfection at the translational levels, immunohistochemistry for vIL-10 was performed with paraffin-embedded slides. Cytoplasmic staining in some bronchial epithelial cells was observed; in some airways the majority of cells are positive, whereas other bronchioles show only scattered positive cells (Fig 3A, B). Positive staining in alveolar epithelial cells was also observed, in both flattened type I cells and more hoblike type II cells (Fig 3C, D). Alveolar macrophages also show cytoplasmic positivity. There is no apparent staining in endothelial cells, stromal cells, or lymphocytes within perivascular cuffs (Fig 3C). These findings confirmed vIL-10 transfection to specific types of cells, and local production of vIL-10 transgene protein within allografts. It was confirmed that the staining was specific to transgene vIL-10 by no staining with the slides in group IV.



View larger version (150K):
[in this window]
[in a new window]
  		Fig 3. Immunohistochemistry for transgene vIL-10. Transgene vIL-10 protein was detected by immunohistochemistry in bronchial epithelial cells, alveolar epithelial cells, and alveolar macrophages (A x100, B x200, C x200, D x400).

 
Exhaled NO levels
To investigate vIL-10 effects on allograft exhaled NO levels, exhaled NO levels were compared between groups. Exhaled NO levels (mean ± SD) in groups I (2.880 ± 2.16 ppb), II (4.640 ± 4.32 ppb), and III (3.240 ± 2.23 ppb) were significantly lower than group IV (12.280 ± 2.83 ppb) (p = 0.0001, p = 0.0013, and p = 0.0003, respectively, ANOVA), whereas exhaled NO from normal left lung of Brown Norway rats (0.00 ± 0.0, n = 5) was significantly lower than all other groups (p < 0.005, ANOVA) (Fig 4). This indicates that exhaled NO levels in normal lungs are so low that they are not detectable in this model. The exhaled NO levels can be remarkably upregulated in allograft rejection, and the upregulation can be significantly suppressed by vIL-10 transfection.



View larger version (13K):
[in this window]
[in a new window]
  		Fig 4. Exhaled nitric oxide (NO) levels (in parts per billion) from rat lung allografts. Exhaled nitric oxide levels in groups I, II, and III were significantly lower than group IV (*p < 0.001 versus group IV, analysis of variance). Exhaled nitric oxide levels in normal lung (NL) was significantly lower than all other groups (**p < 0.005, analysis of variance). Values are mean ± standard deviation of five animals per group.

 
Lung graft function and histologic rejection score
There were no significant differences between groups in arterial oxygen tension, arterial carbon dioxide tension, and peak airway pressures (Table 1). vIL-10 transfection did not affect allograft lung function. There were also no significant differences between groups in either A or B histologic rejection grading (Fig 5). This indicates that allograft vIL-10 transfection did not lead to immunoalteration, which is enough to reach the level of showing histologic difference.


View this table:
[in this window]
[in a new window]
  		Table 1. PaO2, PaCO2, and Peak Airway Pressure

 


View larger version (12K):
[in this window]
[in a new window]
  		Fig 5. Histologic rejection score. The sections were graded separately for both acute vascular rejection (A score) and airway rejection (B score) based on the revised working formulation. There were no significant differences between groups in either A or B histologic rejection grading.

 

   Comment
Top
 Footnotes
 Abstract
 Introduction
 Material and methods
 Results
 Comment
Acknowledgments
 References
 
Our study demonstrates that vIL-10 gene transfer into rat lung allografts caused suppression of graft iNOS mRNA expression and exhaled NO levels by postoperative day (POD) 5 in BN-to-Lewis lung allotransplants, although there was relative lack of dose-dependent effects. In such an RT1-incompatible donor–recipient combination, lung grafts were previously found to be rejected rapidly, between 4 and 6 days after transplantation [13]. This has also been our experience with the BN-to-Fisher strain combination [14]. We expected that fulminate rejection would be present in control recipients if animals were sacrificed on POD 5.

Naked vIL-10 plasmid was used for gene transfer in this study. Despite its relatively low transfection efficiency, we found that it is an effective means for endobronchial gene transfer as reported by other investigators [15, 16]. In contrast to virus- or liposome-mediated methods, direct plasmid DNA gene transfer is associated with less adverse effects, such as inflammation, toxicity, or antigenicity. Direct gene instillation into bronchus also has the advantage of simplicity, noninvasiveness, and selectivity as a means for specifically transferring genes into lung grafts in vivo. Our previous study with endobronchial naked transforming growth factor beta (TGF-ß) 1 gene transfer [17] suggested that this strategy may also apply to vIL-10. The fact that intensity of vIL-10 band in semiquantitative RT-PCR varies from sample to sample may reflect inconsistent transfection efficiency, or inhomogeneous plasmid distribution within allografts following endobronchial transfection.

Upregulated iNOS mRNA expression and increased production of NOS and NO during allograft rejection have been demonstrated in many experimental transplantation models, including rat heart, lung, liver, small bowel, and bone marrow [18]. In the clinical setting, iNOS mRNA upregulation, or elevated serum levels of nitrite and nitrate, has also been observed during cardiac allograft rejection, whereas increased immunosuppressive therapy has been reported to be able to restore these end products to normal levels [19, 20]. Although measurement of exhaled NO levels has become increasingly recognized as a noninvasive marker of a variety of respiratory diseases, increased exhaled NO levels also take place during acute lung allograft rejection. Worrall and colleagues [21] have demonstrated allograft iNOS mRNA upregulation during rejection in rat lung and heart, which was suppressed by immunosuppressive therapy with dexamethasone. Increased exhaled NO levels in rejected rat lung allografts have been also reported [22], and can be suppressed by cyclosporine administration. Suppression of iNOS mRNA expression or exhaled NO levels by vIL-10, suggests that iNOS expression is immune mediated and vIL-10 may at least in part possess immunosuppressive activity.

Our results indicates that allograft vIL-10 transfection significantly suppresses iNOS expression and exhaled NO levels, but does not attenuate the net allograft rejection in terms of lung function and histologic score. The net effect of NO during allograft rejection is difficult to predict because the physiologic consequences could be either suppression of the alloimmune response or potentiation of the rejection process. The potential role of NO as a cytotoxic and cytostatic effector molecule may contribute to allograft destruction by interacting with superoxide anions to produce cytotoxic peroxynitrite radicals. On the other hand, NO was found to have a suppressive effect on in vitro lymphocyte proliferation and cytokine production in the mixed lymphocyte reaction [23]. In the study by Hoffman and Langrehr [24], inhibition of NO synthesis in the sponge matrix allograft model was associated with promotion of allospecific cytotoxic T lymphocyte development and proliferation. Given these opposing effects of NO in in vitro or ex vivo studies, the role of NO in an in vivo alloimmune response is less clear. Worrall and colleagues [25] reported that iNOS inhibition decreased NO production in the transplanted organ and significantly attenuated acute rejection, suggesting a potential cytotoxic role for NO. In contrast, in the murine heart transplant model, Bastian and associates [26] reported that inhibition of NO synthesis did not alter graft survival. Casey and coworkers [27] also demonstrated, using iNOS knockout mice, that lack of iNOS has no net influence on the kinetics of murine skin allograft rejection. Taken together, the net effect of NO in allograft rejection will be determined by a complex balance between its role as an effector molecule on the one hand and its immunomodulatory role on the other. Our findings of allograft iNOS downregulation by vIL-10 may not necessarily indicate the direct vIL-10 immunosuppressive potential. iNOS upregulation in acute allograft rejection, however, seems to be an invariable phenomenon among alloimmune responses, which suggests that this molecule has close involvement with the alloimmune response, and its modulation may, in part, affect the net rejection outcome.

There have been several studies that indicate that local vIL-10 production can suppress immune reactivity in response to alloantigen. Although some reports indicated detrimental effects [28] or ineffectiveness [29] of cellular IL-10, which possesses immunostimulatory activities on allograft rejection, retroviral or lipid-mediated gene transduction of viral IL-10 prolonged graft survival when injected directly into cardiac allografts [30, 31]. vIL-10 gene transfer also decreased allogenic lymphocyte proliferative response to cultured human islets [32]. Several studies that support our results of iNOS suppression by IL-10 have been reported. IL-10 was found to inhibit the induction of iNOS in endothelial cells by cytokines [33]. There are also some in vivo indications that IL-10 counteracts an excessive production of NO. For instance, gene transfer of IL-10 cDNA in mice results in a protective effect against lethal endotoxemia, of which NO is an important component [34]. It seems, however, that there have been few reports that vIL-10 modulates iNOS expression in allotransplantation. One study [35] showed a correlation between these two molecules, which demonstrated that IL-10 knock-out caused accelerated rejection in murine cardiac allografts, and was associated with significant increases in iNOS and INF-{gamma} expression. This finding implies that endogenous IL-10 may attenuate allograft rejection in part, by suppressing NO-driven injury. It is possible that vIL-10 acted as an immunosuppressive molecule, with iNOS downregulation as a net result of attenuated rejection, or as an evidence of its direct or indirect counterregulation against iNOS. The underlying mechanism of iNOS upregulation in rejected allografts and the influence of its downregulation on rejection remain to be elucidated. Our findings of significant graft iNOS suppression due to vIL-10 overexpression suggest that further immunosuppressive therapy might be accomplished by more efficient conditions of naked gene transfer or by virus or lipid-mediated gene transfer.

In conclusion, our study demonstrated that endobronchial transfection of naked vIL-10 significantly suppressed allograft iNOS expression and exhaled NO levels in rat lung allograft rejection. An association between iNOS upregulation and high exhaled NO levels in lung allograft rejection was also noted.


   Acknowledgments
Top
 Footnotes
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 Acknowledgments
References
 
The authors thank Paul J. Goodfellow, PhD, for assistance with gel image processing, Richard B. Schuessler, PhD, for the statistical consultation, Kathleen Grapperhaus, for experimental set-up, and Dawn Schuessler and Marry Ann Kelly for secretarial assistance. This work was supported by the National Institutes of Health grants RO1 HL-41281 (GAP) and RO1 HL56643 (TM), and Genzyme Corporation. Timothy J. McCarthy was supported by the Whitaker Foundation. Hideki Itano was supported by the Okayama University Medical School.


   Footnotes
Top
 Footnotes
Abstract
 Introduction
 Material and methods
 Results
 Comment
 Acknowledgments
 References
 
Dr Yew is an employee of Genzyme Corporation, which partially supported this study.


   References
Top
 Footnotes
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 Acknowledgments
 References
 

  1. Meyers B.F., Lynch J., Trulock E.P., Guthrie T.J., Cooper J.D., Patterson G.A. Lung transplantation: a decade of experience. Ann Surg 1999;230:362-370.[Medline]
  2. de Waal Malefyt R., Abrams J., Bennet B., Figdor C.G., de Vries J.E. Interleukin-10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 1991;174:1209-1220.[Abstract/Free Full Text]
  3. Moorre K.W., O’Garra A., de Waal Malefyt R., Viera P., Mosmann T.R. Interleukin-10. Annu Rev Imunol 1993;11:165-190.[Medline]
  4. Howard M., O’Garra A., Ishida H., de Waal Malefyt R., de Vries J.E. Biological properties of interleukin-10. Clin Immunol 1992;12:239-247.
  5. Delvaux A., Donckier V., Bruyns C., et al. Effects of systemic administration of rIL-10 in an in vivo model of alloreactivity. Transplantation 1994;58:972-974.[Medline]
  6. Chen W.-F., Zlotnik A. Il-10: a novel cytotoxic T cell differentiation factor. J Immunol 1990;147:528-534.[Abstract]
  7. Go N.F., Castle B.E., Barrett R., et al. Interleukin 10, a novel B cell stimulatory factor. Unresponsiveness of X chromosome-linked immunodeficiency B cells. J Exp Med 1990;172:1625-1631.[Abstract/Free Full Text]
  8. Hsu D.H., De Waal Malefyt R., Fiorentino D.F., et al. Expression of interleukin-10 activity by Epstein Barr virus protein BCRF-1. Science 1990;250:830-832.[Abstract/Free Full Text]
  9. De Waal Malefyt R., Haanen J., Spits H., et al. Interleukin-10 (IL-10), and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulating of class II major histocompatibility complex expression. J Exp Med 1991;174:915-924.[Abstract/Free Full Text]
  10. Lee E.R., Marshall J., Siegel C.S., et al. Detailed analysis of structures and formulations of cationic lipids for efficient gene transfer to the lung. Hum Gene Therapy 1996;7:1701-1717.[Medline]
  11. Mizuta T., Kawaguchi A., Nakahara K., et al. Simplified rat lung transplantation using a cuff technique. J Thorac Cardiovasc Surg 1991;102:159-160.[Medline]
  12. Yousem S.A., Berry G.J., Cagle P.T., et al. Revision of the 1990 working formulation for the classification of pulmonary allograft rejection: Lung Rejection Study Group. J Heart Lung Transplant 1996;15:1-15.[Medline]
  13. Prop J., Nieuwenhuis P., Wildewuur C.R.H. Lung allograft in the rat. I. Accelerated rejection cause by graft lymphocytes. Transplantation 1985;40:25-30.[Medline]
  14. Worrall N.K., Boasquevisque C.H., Botney M.D., et al. Inhibition of inducible nitric oxide synthase ameliorates functional and histological changes of acute lung allograft rejection. Transplantation 1997;63:1095-1101.[Medline]
  15. Tsan M.F., White J.E., Shepard B. Lung-specific direct in vivo gene transfer with recombinant plasmid DNA. Am J Physiol 1995;268(Lung Cell Mol Physiol 12):L1052-L1056.[Abstract/Free Full Text]
  16. Zabner J., Cheng S.H., Meeker D., et al. Comparison of DNA–lipid complexes, and DNA alone for gene transfer to cystic fibrosis airway epithelia in vivo. J Clin Invest 1997;100:1529-1537.[Medline]
  17. D’Ovidio F., Yano M., Ritter J.H., Mohanakumar T., Patterson G.A. Endobronchial transfection of naked TGF-{gamma} 1 cDNA attenuates acute lung rejection. Ann Thorac Surg 1999;68:1008-1013.[Abstract/Free Full Text]
  18. Yang X., Chowdhury N., Cai B., et al. Induction of myocardial nitric oxide synthase by cardiac allograft rejection. J Clin Invest 1994;94:714-721.
  19. Lewis N.P., Tsao S.P., Rickenbacher P.R., et al. Induction of inducible nitric oxide synthase (iNOS) mRNA in the human cardiac allograft is associated with impaired left ventricular contractile function. Circulation 1996;93:720-729.[Abstract/Free Full Text]
  20. Benvenuti C., Bories P.N., Loisance D. Increased serum nitrate concentration in cardiac transplant patients. A marker for acute allograft cellular rejection. Transplantation 1996;61:745-749.[Medline]
  21. Worrall N.K., Boasquevisque C.H., Botney M.D., et al. Inhibition of inducible nitric oxide synhase ameliorates functional and histological changes of acute lung allograft rejection. Transplantation 1997;63:1095-1101.
  22. Mizuta T., Fujii Y., Minami M., et al. Increased nitric oxide levels in exhaled air of rat lung allografts. J Thorac Cardiovasc Surg 1997;113:830-835.[Abstract/Free Full Text]
  23. Hoffman R.A., Langrehr J.M., Billiar T.R., Curran R.D., Simmons R.L. Alloantigen-induced activation of rat splenocytes is regulated by the oxydative metabolism of L-arginine. J Immunol 1990;145:2220-2226.[Abstract]
  24. Hoffman R.A., Langrehr J.M., Dull K.E., Simmons R.L. Nitric oxide production by mouse sponge matrix allograft-infiltrating cells. Transplantation 1993;55:591-596.[Medline]
  25. Worrall N.K., Lazenby W.D., Misko T.P., et al. Modulation of in vivo alloractivity by inhibition of inducible nitric oxide synthase. J Exp Med 1995;181:63-70.[Abstract/Free Full Text]
  26. Bastian N.R., Xu S., Shao X.L., Shelby J., Granger D.L., Hibbs J.B., Jr N-omega-monomethyl-L-arginine inhibits nitric oxide production in murine cardiac allografts but does not affect graft rejection. Biochim Biophys Acta 1994;1226:225-231.[Medline]
  27. Casey J.J., Wei X.Q., Orr D.J., et al. Skin allograft rejection in mice lacking inducible nitric oxide synthase. Transplantation 1997;64:589-593.[Medline]
  28. Qian S., Li W., Li Y., et al. Systemic administration of cellular interleukin-10 can exacerbate cardiac allograft rejection in mice. Transplantation 1996;62:1709-1714.[Medline]
  29. Lee M.S., Wogensen L., Shizuru J., Oldstone M.B.A., Sarvetnick N. Pancreatic islet production of murine interleukin-10 does not inhibit immune-mediated tissue destruction. J Clin Invest 1994;93:1332-1338.
  30. Qin L., Chavin K.D., Ding Y., et al. Retrovirus-mediated transfer of viral IL-10 gene prolonged murine cardiac allograft survival. J Immunol 1996;156:2316-2323.[Abstract]
  31. DeBruyne L.A., Li K., Chan S.Y., Qin L., Bishop D.K., Bromberg J.S. Lipid-mediated gene transfer of viral IL-10 prolongs vascularized cardiac survival by inhibiting donor-specific cellular and humoral immune responses. Gene Ther 1998;5:1079-1087.[Medline]
  32. Benhamou P.Y., Mullen Y., Shaked A., Bahmiller D., Csete M.E. Decreased alloreactivity to human islets secreting recombinant viral interleukin-10. Transplantation 1996;62:1306-1312.[Medline]
  33. Schneemann M., Schoedon G., Frei K., Schaffner A. Immunovascular communication: activation and deactivation of murine endothelial cell nitric oxide synthase by cytokines. Immunol Lett 1993;35:159-162.[Medline]
  34. Rogy M.A., Auffenberg T., Espat N.J., et al. Human tumor necrosis factor receptor (p55) and interleukin-10 gene transfer in the mouse reduces mortality to lethal endotoxemia and also attenuates local inflammatory responses. J Exp Med 1995;181:2289-2293.[Abstract/Free Full Text]
  35. Risnen-Sokolowski A., Mottram P.L., Glysing-Jensen T., Satoskar A., Russel M.E. Heart transplants in interferon-gamma, interleukin 4, and interleukin 10 knockout mice. Recipient environment alters graft rejection. J Clin Invest 1997;100:2449-2456.[Medline]



This article has been cited by other articles:


Home page
 Eur. J. Cardiothorac. Surg.Home page
M. G. Saueressig, A. M. Neto, E. A.F. Fortis, D. Westphal, M. I.A. Edelweiss, L. Meurer, and U. Matte
Vascular endothelial growth factor gene therapy induces early re-establishment of canine bronchial circulation
Eur. J. Cardiothorac. Surg., April 1, 2008; 33(4): 717 - 722.
[Abstract] [Full Text] [PDF]

Home page
 J. Thorac. Cardiovasc. Surg.Home page
S. A. Kanaan, B. D. Kozower, T. Suda, N. Daddi, T. Tagawa, J. H. Ritter, T. Mohanakumar, and G. A. Patterson
Intratracheal adenovirus-mediated gene transfer is optimal in experimental lung transplantation
J. Thorac. Cardiovasc. Surg., December 1, 2002; 124(6): 1130 - 1136.
[Abstract] [Full Text]

Home page
 J. Thorac. Cardiovasc. Surg.Home page
N. Daddi, T. Suda, F. D'Ovidio, S. A. Kanaan, T. Tagawa, K. Grapperhaus, B. D. Kozower, J. H. Ritter, N. S Yew, T. Mohanakumar, et al.
Recipient intramuscular cotransfection of naked plasmid transforming growth factor {beta}1 and interleukin 10 ameliorates lung graft ischemia-reperfusion injury
J. Thorac. Cardiovasc. Surg., August 1, 2002; 124(2): 259 - 269.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Itano, H.
Right arrow Articles by Patterson, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itano, H.
Right arrow Articles by Patterson, G. A.
Related Collections
Right arrow Lung - transplantation

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ANN THORAC SURG ASIAN CARDIOVASC THORAC ANN EUR J CARDIOTHORAC SURG
J THORAC CARDIOVASC SURG ICVTS ALL CTSNet JOURNALS