| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Ann Thorac Surg 2000;70:930-936
© 2000 The Society of Thoracic Surgeons
B sensitizes non–small cell lung cancer cells to chemotherapy-induced apoptosis
a Department of Surgery, The University of Virginia, Charlottesville, Virginia, USA
b Department of Biology, The University of North Carolina, Chapel Hill, North Carolina, USA
Address reprint requests to Dr Jones, Thoracic and Cardiovascular Surgery, University of Virginia, PO Box 800679, Charlottesville, VA 22908-0679
e-mail: djones{at}virginia.edu
Presented at the Thirty-sixth Annual Meeting of The Society of Thoracic Surgeons, Ft Lauderdale, FL, Jan 31–Feb 2, 2000.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterial and methodsResultsCommentReferences |
|---|
B) activation in NSCLC in vitro and whether inhibition of NF-B would sensitize tumor cells to undergo chemotherapy-induced apoptosis.
Methods. Non–small cell lung cancer cells were treated with gemcitabine, harvested, and nuclear extracts analyzed for NF-B DNA binding by electrophoretic mobility shift assays. Additionally, NSCLC cells that stably expressed a plasmid encoding the superrepressor IB
protein (H157I) or a vector control (H157V) were generated. These cells were then treated with gemcitabine and apoptosis determined by terminal deoxynucleotidyl transferase mediated nick end labeling (TUNEL) assay.
Results. Chemotherapy induced NF-B nuclear translocation and DNA binding in all NSCLC cell lines. H157I cells had enhanced cell death compared with H157V cells, suggesting that NF-B is required for cell survival after chemotherapy. The observed cell death following the loss of NF-B occurred by apoptosis.
Conclusions. Inhibition of chemotherapy-induced NF-B activation sensitizes NSCLC to chemotherapy-induced apoptosis in vitro. Novel treatment strategies for patients with advanced NSCLC may involve chemotherapy combined with inhibition of NF-B-dependent cell-survival pathways.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterial and methodsResultsCommentReferences |
|---|
Eighty percent of all newly diagnosed lung cancers are non–small cell lung cancers (NSCLC), and more than 75% present late with stage III or IV disease [2]. Additionally, in patients who undergo complete resection of a stage I or II NSCLC, two thirds of the first recurrences will be distant [3]. Because of this advanced stage at presentation in patients with NSCLC and a predilection for distant recurrences after surgery, chemotherapy alone or in combination with surgery or radiation is a common treatment strategy. Chemotherapy is also included in most induction therapy protocols, which are designed to "downstage" NSCLC, thus potentially improving resectability rates.
The advent of new third-generation chemotherapeutic agents has created a cautious wave of optimism for patients with advanced stage NSCLC [4]. Unfortunately, in patients with NSCLC treated with single agent or combination third-generation chemotherapeutic agents, the partial response rates are only 30% to 55%. Complete response rates are very uncommon [4, 5]. Thus, most NSCLCs remain chemoresistant.
The problem of chemoresistance in NSCLC has been complicated by a significant lack of understanding of the cell-signaling mechanisms involved in chemotherapy-induced cell death. Tumor chemoresistance has been associated with a number of factors including amplification of the MDRP1 P-glycoprotein, mutated p53, overexpression of glutathione S-transferase, DNA repair enzymes, Bcl-2 family members, and various oncogenes [6].
More recently, chemoresistance in selected tumors has been linked to the activation of an antiapoptotic transcription factor, nuclear factor-kappa B (NF-B) [7, 8]. NF-B is an inducible member of the Rel family of transcription factors of which there are presently five known proteins: c-Rel, p50, p65, p52, and RelB [9]. All of these proteins contain the Rel homology domain, which is responsible for dimerization, DNA binding, and interactions with IB-like molecules. Classic NF-B is a heterodimer composed of p50 and p65. NF-B is maintained in the cytoplasm where it is inactive, through an interaction of the p65 or c-Rel subunit with the inhibitor protein, IB [9, 10]. NF-B is activated by cytokines, 
-irradiation, and certain chemotherapeutic agents that subsequently lead to the phosphorylation, ubiquitination, and proteosome-mediated degradation of IB [9, 11, 12]. Once NF-B dissociates from I 66 it translocates to the nucleus, where it transcriptionally upregulates antiapoptotic and other gene products. The recent discovery of phosphorylation sites, required for proteosome-mediated degradation of IB and subsequent nuclear translocation of NF-B, facilitated the generation of a superrepressor mutant of IB (IB-SR) [13]. IB-SR cannot be phosphorylated or degraded and, as a result, acts as a dominant-negative repressor to selectively inhibit NF-B nuclear translocation, and therefore transcription, in response to cellular stimulation [13].
The purpose of this study was to determine whether NF-B is activated in vitro by chemotherapy in human NSCLC. The chemotherapeutic agent used in this study was gemcitabine, a third-generation cytidine analogue that has been shown to have response rates of approximately 40% in NSCLC [4, 14]. Secondly, we wanted to determine whether NF-B is required for cell survival following the addition of chemotherapy. Finally, we wanted to ascertain whether the loss of NF-B sensitizes NSCLC cells to chemotherapy and whether the resulting cell death occurs by apoptosis.
|
Material and methods |
|---|
|
TopAbstractIntroductionMaterial and methodsResultsCommentReferences |
|---|
Measurement of chemotherapy-induced NF-B nuclear translocation
Twenty-four hours later the H157, H358, and H460 cells were 60% to 70% confluent and were either not treated or exposed to gemcitabine (1 µmol/L) (Eli Lilly and Company, Indianapolis, IN). This dose of gemcitabine was chosen as it closely reflects human serum levels [14]. Cells were harvested before (T0) or after the addition of gemcitabine at 2, 4, 6, and 8 hours. As a positive control cells were treated for 15 minutes with tumor necrosis factor (TNF; 10 ng/mL per plate) (Roche Diagnostics, Indianapolis, IN), a known activator of NF-B [9, 12].
Nuclear extracts were prepared for the above experimental conditions. Briefly, cells were washed twice with ice-cold phosphate-buffered saline, scraped gently from the plates, transferred to microcentrifuge tubes, and lysed on ice in three pellet volumes of cytoplasmic extraction buffer (10 mmol/L HEPES [pH 7.6], 60 mmol/L KCl, 1 mmol/L EDTA (ethylenediaminetetraacetic acid), 0.1% Nonidet p-40, 1 mmol/L dithiothreitol, 1 mmol/L phenylmethylsulfonyl fluoride, and 1 µg each of aprotinin, leupeptin, and pepstatin per milliliter). Nuclei were pelleted (1,800 x g, 4°C, 5 minutes), and maintained on ice. Nuclei were washed gently with 100 µL of cytoplasmic extraction buffer without Nonidet P-40 and pelleted (1,800 x g, 4°C, 5 minutes), and the supernatants were discarded. Two pellet volumes of nuclear extraction buffer (20 mmol/L Tris [pH 8.0], 420 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.5 mmol/L phenylmethylsulfonyl fluoride, 25% glycerol, and 1.0 µg each of aprotinin, leupeptin, and pepstatin per milliliter) were added, and the final salt concentration was adjusted to 400 mmol/L with 2.5 mol/L NaCl. Nuclear pellets were resuspended by vortexing and incubated on ice for 10 minutes. Finally, nuclear extracts were cleared (16,000 x g, 4°C, 10 minutes) and transferred to fresh tubes. Protein concentrations were determined by the Bradford assay using the Bio-Rad protein assay dye reagent (Bio-Rad Laboratories, Hercules, CA), and all nuclear extracts stored at -70°C.
NF-B nuclear translocation was determined by electrophoretic mobility shift assay (EMSA) analysis. Equal amounts of nuclear extracts (8 µg) were incubated in a total volume of 20 µL of binding buffer for 20 minutes at room temperature with a [32P]-labeled double-stranded probe containing a B consensus site (underlined) from the class I major histocompatibility complex promoter (5'CAGGGCTGGGGATTCCCCATCTCCACAGTTTCACTTC3'). The binding buffer consisted of 10 mmol/L Tris (pH 7.7), 50 mmol/L NaCl, 0.5 mmol/L EDTA, 1 mmol/L dithiothreitol, 10% glycerol, and 1 µg of poly(dI-dC)-poly(dI-dC) (Pharmacia Biotech, Piscataway, NJ). DNA-protein complexes were separated on 5% polyacrylamide gels in Tris-glycine buffer (25 mmol/L Tris, 190 mmol/L glycine, and 1 mmol/L EDTA), dried, and underwent autoradiography.
For supershift experiments, 2 µg of rabbit polyclonal antibodies against the p50 subunit (NLS; Santa Cruz Biotechnology, Santa Cruz, CA) or the p65 subunit (Rockland, Gilbertsville, PA) of NF-B were incubated with the nuclear extracts 10 minutes before the addition of the [32P]-labeled probe and then analyzed as described above. Addition of the p50 antibody to the nuclear localization sequence results in no demonstrable NF-B DNA binding while addition of the p65 antibody results in a gel shift of the p65 protein. Three independent experiments (exclusive of the supershift analysis) were performed for each NSCLC cell line.
Generation of stably expressing dominant-negative NF-B cell lines
To better analyze the functional role of chemotherapy-induced NF-B activation, generation of a stably transfected NSCLC cell lines was carried out. The H157 NSCLC cell line was chosen to be stably transfected with a plasmid encoding the IB-SR (generously provided by D. Ballard, Vanderbilt University). Briefly, parental H157 cells were cotransfected with either 2 µg of the pCMV-IB expression plasmid or a vector control plasmid and 0.2 µg of puromycin-N-acetyl transferase DNA utilizing 18 µL of Lipofectamine reagent (Life Technologies) for each sample. Cells were allowed to grow under puromycin selection, and individual clones were subsequently harvested and expanded into cell lines.
Once the cells were of an adequate density, they were harvested in iced phosphate-buffered saline and whole-cell lysates prepared by resuspending cell pellets in ice-cold RIPA buffer (10 mmol/L Tris-HCl [pH 8.0], 1 mmol/L EDTA, 1% sodium dodecyl sulfate, 1% Nonidet P-40). Pellets were incubated on ice for 20 minutes. Supernatant lysates were collected following high-speed centrifugation for 20 minutes at 4°C. Equal amounts of protein extracts (50 µg) were electrophoresed on 10% polyacrylamide-sodium dodecyl sulfate gels and transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, NH). Blocking was performed in 0.5% nonfat dry milk-1 x TBST (25 mmol/L Tris-HCl [pH 8.0], 125 mmol/L NaCl, 0.1% Tween 20). Western blots were analyzed for the expression of IB using an IB-specific primary antibody (C21, Santa Cruz Biotechnology), horseradish peroxidase-conjugated anti-rabbit secondary antibody, followed by enhanced chemiluminescence (Amersham, Cleveland, OH). Clones expressing the IB-SR were renamed H157I while the vector control cells were renamed H157V. To confirm that the IB-SR protein was functional EMSA analysis was performed in the absence or presence of gemcitabine (1 µmol/L).
Measurement of apoptosis
The H157 I and H157V cells (1 x 105 cells/well) were plated on glass cover slips and allowed to adhere overnight. Eighteen hours later cells were treated with gemcitabine (1 to 10 µmol/L) and incubated at 37°C. Cells were fixed in 4% paraformaldehyde 48 hours after gemcitabine treatment and TUNEL analysis performed (Roche Diagnostics). Cells were also exposed to ultraviolet irradiation, a known inducer of apoptosis, as a positive control. Apoptosis was identified on phase-shift microscopy by the typical morphologic changes of membrane blebbing, condensation, and nuclear fragmentation. TUNEL-positive cells were observed as fluorescein isothiocyanate-labeled bodies on the fluorescent microscope. Apoptosis was quantitated by counting the number of apoptotic cells in five separate fields and reported as the average percent of apoptotic cells ± SEM. The experiment was repeated three times with two replicates per experiment. Data were analyzed for significance using analysis of variance followed by Bonferroni’s multiple comparisons test. Statistical significance was set at p less than 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterial and methodsResultsCommentReferences |
|---|
B nuclear translocationB DNA-binding activity, as compared with nuclear extracts from unstimulated cells (Fig 1). The ability of gemcitabine to stimulate NF-B activation was not cell line-specific, because similar results were also obtained using additional NSCLC cell lines (NCI-125, NCI-A549, data not shown). Gemcitabine-induced NF-B nuclear translocation and DNA-binding was not as robust as that induced by the cytokine TNF.
|
B activation shows that maximal NF-B nuclear translocation occurred 4 to 8 hours following the addition of gemcitabine (Fig 2). Gel-shift analysis of NF-B activation at time points earlier than 2 hours showed little NF-B DNA-binding (data not shown). Supershift analysis of the protein/DNA complexes using antibodies specific for either the p65 or p50 subunit of NF-B confirmed that the nuclear proteins identified by EMSA were composed of the "classic" NF-B heterodimer.
|
B cell linesB-SR, which acts as a dominant-negative suppressor of NF-B activation. As shown in Figure 3A, an isolated clone of H157 NSCLC cells clearly overexpressed the IB-SR compared with the parental and vector control cell lines. The clone of cells expressing the IB-SR protein was renamed H157I, whereas that expressing the vector control was renamed H157V.
|
B activation, these cells, along with the H157V cells, were treated with gemcitabine, then nuclear extracts were isolated and EMSAs were carried out. The H157I cells had no induction of NF-B nuclear translocation after treatment with gemcitabine whereas the H157V cells had the expected NF-B nuclear translocation following chemotherapy (Fig 3B). This inhibition of chemotherapy-induced NF-B activation in the H157I cells demonstrated conclusively that overexpression of the IB-SR functioned as a dominant-negative repressor of NF-B.
Inhibition of NF-B chemosensitizes non–small cell lung cancer cells
To determine the effect of inhibition of NF-B activation on chemotherapy-induced cell death, H157I and H157V cells were incubated with varying concentrations of gemcitabine and cell death rates evaluated. As shown in Figure 4, the H157I cells were markedly more chemosensitive than the vector control cell line, H157V. Maximal tumor cell death occurred with 1-µmol/L concentrations of gemcitabine (same dose used to induce NF-B activation) although concentrations 100x lower killed more cells in the H157I cell line compared with the vector control at the same time point postchemotherapy. Tumor cell death as determined by cell count began to occur as early as 18 to 24 hours after chemotherapy and appeared to be maximal by 72 hours.
|
B inhibition occurs by apoptosis
|
|
|
Comment |
|---|
|
TopAbstractIntroductionMaterial and methodsResultsCommentReferences |
|---|
Since its discovery in 1986 by Baltimore, NF-B increasingly has been shown to be involved in inflammatory and cytokine-mediated cell processes [9, 15, 16]. Recently, several studies have established that genotoxic stressors such as chemotherapy can induce NF-B activation [7, 11]. Etoposide, CPT-11, Adriamycin, vinca alkaloids, and Taxol have all been shown to activate NF-B [7, 11, 17]. Once activated by chemotherapy, NF-B has been shown to provide an antiapoptotic function by promoting cell survival of fibrosarcoma and colorectal carcinoma cell lines [7, 17]. In an effort to better understand the cell-signaling pathways involved in chemoresistance in NSCLC, our laboratory has been exploring the antiapoptotic role of NF-B in overcoming chemotherapy-mediated cell death.
This study established clearly that clinical doses of gemcitabine induce NF-B activation in several different NSCLC cell lines in vitro. Subsequently we have performed EMSA experiments using other chemotherapeutic agents commonly used to treat NSCLC tumors, including cisplatin and CPT-11. We have found that the addition of these agents results in NF-B activation in those NSCLC cell lines evaluated. These results suggest that the observations described herein are not chemotherapeutic agent specific. Combination chemotherapy experiments are currently being performed to determine if there may be a synergistic effect on NF-B activation.
In contrast to TNF-induced NF-B activation, which occurs in minutes [9, 10], chemotherapy appears to activate NF-B much later (hours) in our cell lines. This observed time course of chemotherapy-induced NF-B activation is supported by other studies [17], and suggests that cell signals upstream of NF-B activation may be different for chemotherapy and cytokine-induced NF-B activation. Cytokine-induced NF-B activation occurs by recently identified kinases (IKK1 and 2) that phosphorylate serines 32 and 36 on IB, initiating ubiquitination and proteosome degradation of IB proteins [18]. It is unclear whether chemotherapy-induced NF-B activation occurs through the same signaling pathway, although our observation of a difference in the time course of NF-B activation suggests different pathways.
To establish whether NF-B was required or necessary for cell survival following chemotherapy in NSCLC, we were able to effectively inhibit NF-B activation by generating cell lines that stably expressed a dominant-negative repressor of NF-B. Expression of the dominant-negative protein in the H157I cell line was confirmed by Western blot analysis. The ability of the IB-SR protein to inhibit chemotherapy-induced NF-B activation was demonstrated by EMSA. As shown in Figure 4, when NF-B activation was inhibited completely, the tumor cells were markedly sensitized to chemotherapy. This finding suggests that NF-B activation provides a cell survival signal following chemotherapy. Our laboratory, and others, have recently begun to dissect which antiapoptotic gene products are regulated by NF-B [8, 19]. Members of the inhibitors of apoptosis protein family, c-IAP-1 and c-IAP-2, as well as A1, a Bcl-2 homologue, are now known to be transcriptionally regulated by NF-B. It is thought that upregulation of these proteins, as well as others, can rescue chemotherapy-mediated cell death by inhibition of specific components of the caspase cascade [19]. NF-B may also have an important antiapoptotic role by controlling cell growth and differentiation through transcriptional regulation of cyclin D1 [20]. Finally, NF-B activation has been shown to be involved in oncogenesis induced by oncogenic Ras by suppressing p53-independent apoptosis [21].
Cell death occurs through two different and sometimes additive processes, necrosis and apoptosis. The decrease in cell number observed in the H157I compared with the H157V cells may have occurred secondary to cell growth inhibition or necrotic cell death. As shown in Figures 5 and 6, the decrease in cell number in the absence of NF-B (H157I) after treatment with chemotherapy was secondary to apoptotic cell death. There were significantly more apoptotic cells in the absence of NF-B (H157I) compared with cells that had functional NF-B activity (H157V). This finding suggests that chemotherapy-mediated cell death in the absence of NF-B may occur by activation of the caspase cascade, which results in apoptosis. Other studies have confirmed that chemotherapy kills tumor cells by caspase activation [22, 23]. We did not specifically evaluate chemotherapy-induced caspase activation in this study, but have preliminary evidence that the mechanism of chemotherapy-induced cell death in NSCLC cells lacking functional NF-B does not involve activation of the cell membrane death receptor Fas, a known activator of the caspase cascade [24].
A limitation of this study was that the experiments performed to date were in transformed cell lines that do not have the same growth characteristics as the original tumor and thus only approximate in vivo controls. Unfortunately, primary tumor cell cultures rarely survive and therefore are not available for analysis. It is not uncommon for cell-signaling studies such as this one to begin with in vitro experiments using transformed cell lines and then progress to in vivo experimentation.
Our observations of chemotherapy-induced NF-B activation and the resulting chemosensitization when NF-B is inhibited, demonstrate that activation of NF-B is a novel mechanism of chemoresistance in NSCLC. Mukhopadhyay and colleagues [25] demonstrated increased expression of the p50 subunit of NF-B in 80% of fresh human NSCLC tissues compared with normal adjacent lung tissue. This observation, coupled with our identification of basal levels of NF-B in our NSCLC cell lines, suggests that NSCLC may have altered levels of NF-B de novo, which when activated by chemotherapy, provide a tumor cell survival function. This study’s finding that inhibition of NF-B resulted in significant chemosensitization in our NSCLC cell line suggests that NF-B is a good cancer drug target. There are several different strategies to inhibit NF-B activation, including the administration of proteosome-specific protease inhibitors such as MG132, PS-341, aprotinin, or treatment with various antioxidants such as N-acetylcysteine and PDTC [26]. Other substances that have been shown directly or indirectly to block NF-B activation include TGF-ß1, Tosylphenylalanyl chloromethyl ketone (TPCK) a serine/threonine protease inhibitor, and steroids [26]. Finally, our laboratory and others have been able to introduce the IB-SR protein into tumor cells though adenoviral-mediated gene delivery and have observed a similar cytotoxic response to TNF and chemotherapy [17, 27].
In conclusion, this study has demonstrated that chemotherapy induces NF-B activation in NSCLC in vitro, which is required for cell survival after chemotherapy. More importantly, inhibition of this chemotherapy-induced NF-B activation significantly chemosensitizes the NSCLC cells to die by apoptosis. Thus, cell-signaling pathways involving NF-B activation are likely to be an important mechanism of chemoresistance in NSCLC. Although future in vivo studies are needed to confirm our findings, these preliminary results have identified NF-B as a potential molecular target for novel pharmaceuticals or gene therapy in patients with locoregionally advanced or metastatic NSCLC.
|
References |
|---|
|
TopAbstractIntroductionMaterial and methodsResultsCommentReferences |
|---|
B antiapoptosis. Science 1998;281:1680-1683.B and IB proteins. Ann Rev Immunol 1996;14:649-681.[Medline]
B proteins. Cancer Biol 1999;8:75-82.
B by antineoplastic agents. J Biol Chem 1997;272:14914-14920.B in cytokine gene regulation. Am J Respir Cell Mol Biol 1997;17:3-9.B/IB proteins. Cancer Biol 1997;8:63-73.
B kinases essential for NF-B activation. Science 1997;278:860-866.B induces expression of the Bcl-2 homologue A1/Bfl-1 to preferentially suppress chemotherapy-induced apoptosis. Mol Cell Biol 1999;19:5923-5929.B controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol 1999;19:5785-5799.B activation to suppress p53-independent apoptosis induced by oncogenic ras. Science 1997;278:1812-1815.B inhibition is Fas independent. Surg Forum 1999:L152-L154.
B transcription factor complex in non-small cell lung carcinoma. Oncogene 1995;11:999-1003.[Medline]
B gene transfer is cytotoxic to squamous-cell lung cancer cells and sensitizes them to tumor necrosis factor--mediated cell death. Am J Respir Cell Mol Biol 1999;21:238-245.Related Article
This article has been cited by other articles:
|
|
 |
|
  G. W. Tew, E. L. Lorimer, T. J. Berg, H. Zhi, R. Li, and C. L. Williams SmgGDS Regulates Cell Proliferation, Migration, and NF-{kappa}B Transcriptional Activity in Non-small Cell Lung Carcinoma J. Biol. Chem., January 11, 2008; 283(2): 963 - 976. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Colado, S. Alvarez-Fernandez, P. Maiso, J. Martin-Sanchez, M. B. Vidriales, M. Garayoa, E. M. Ocio, J. C. Montero, A. Pandiella, and J. F. San Miguel The effect of the proteasome inhibitor bortezomib on acute myeloid leukemia cells and drug resistance associated with the CD34+ immature phenotype Haematologica, January 1, 2008; 93(1): 57 - 66. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Liu, P. W. Smith, and D. R. Jones Breast Cancer Metastasis Suppressor 1 Functions as a Corepressor by Enhancing Histone Deacetylase 1-Mediated Deacetylation of RelA/p65 and Promoting Apoptosis Mol. Cell. Biol., December 1, 2006; 26(23): 8683 - 8696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. F. McCarty and K. I. Block Preadministration of High-Dose Salicylates, Suppressors of NF-{kappa}B Activation, May Increase the Chemosensitivity of Many Cancers: An Example of Proapoptotic Signal Modulation Therapy. Integr Cancer Ther, September 1, 2006; 5(3): 252 - 268. [Abstract] [PDF]
|
|
|
|
 |
|
 J. Xie and Z. A. Shaikh Cadmium-Induced Apoptosis in Rat Kidney Epithelial Cells Involves Decrease in Nuclear Factor-Kappa B Activity Toxicol. Sci., May 1, 2006; 91(1): 299 - 308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. T. Stathopoulos, Z. Zhu, M. B. Everhart, I. Kalomenidis, W. E. Lawson, S. Bilaceroglu, T. E. Peterson, D. Mitchell, F. E. Yull, R. W. Light, et al. Nuclear Factor-{kappa}B Affects Tumor Progression in a Mouse Model of Malignant Pleural Effusion Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 142 - 150. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Denlinger, B. K. Rundall, and D. R. Jones Inhibition of phosphatidylinositol 3-kinase/Akt and histone deacetylase activity induces apoptosis in non-small cell lung cancer in vitro and in vivo J. Thorac. Cardiovasc. Surg., November 1, 2005; 130(5): 1422 - 1429. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Tsurutani, S.S. Castillo, J. Brognard, C. A. Granville, C. Zhang, J. J. Gills, J. Sayyah, and P. A. Dennis Tobacco components stimulate Akt-dependent proliferation and NF{kappa}B-dependent survival in lung cancer cells Carcinogenesis, July 1, 2005; 26(7): 1182 - 1195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Denlinger, B. K. Rundall, and D. R. Jones Proteasome inhibition sensitizes non-small cell lung cancer to histone deacetylase inhibitor-induced apoptosis through the generation of reactive oxygen species J. Thorac. Cardiovasc. Surg., November 1, 2004; 128(5): 740 - 748. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Denlinger, B. K. Rundall, M. D. Keller, and D. R. Jones Proteasome Inhibition Sensitizes Non-Small-Cell Lung Cancer to Gemcitabine-Induced Apoptosis Ann. Thorac. Surg., October 1, 2004; 78(4): 1207 - 1214. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Guo, U. N. Verma, R. B. Gaynor, E. P. Frenkel, and C. R. Becerra Enhanced Chemosensitivity to Irinotecan by RNA Interference-Mediated Down-Regulation of the Nuclear Factor-{kappa}B p65 Subunit Clin. Cancer Res., May 15, 2004; 10(10): 3333 - 3341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Denlinger, M. D. Keller, M. W. Mayo, R. M. Broad, and D. R. Jones Combined proteasome and histone deacetylase inhibition in non-small cell lung cancer J. Thorac. Cardiovasc. Surg., April 1, 2004; 127(4): 1078 - 1086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Mayo, C. E. Denlinger, R. M. Broad, F. Yeung, E. T. Reilly, Y. Shi, and D. R. Jones Ineffectiveness of Histone Deacetylase Inhibitors to Induce Apoptosis Involves the Transcriptional Activation of NF-{kappa}B through the Akt Pathway J. Biol. Chem., May 23, 2003; 278(21): 18980 - 18989. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Wang, B. J. Manning, Q. D. Wu, S. Blankson, D. Bouchier-Hayes, and H. P. Redmond Endotoxin/Lipopolysaccharide Activates NF-{kappa}B and Enhances Tumor Cell Adhesion and Invasion Through a {beta}1 Integrin-Dependent Mechanism J. Immunol., January 15, 2003; 170(2): 795 - 804. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Xu and M. A. Villalona-Calero Irinotecan: mechanisms of tumor resistance and novel strategies for modulating its activity Ann. Onc., December 1, 2002; 13(12): 1841 - 1851. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. Jones, R. M. Broad, L. D. Comeau, S. J. Parsons, and M. W. Mayo Inhibition of nuclear factor {kappa}B chemosensitizes non-small cell lung cancer through cytochrome c release and caspase activation J. Thorac. Cardiovasc. Surg., February 1, 2002; 123(2): 310 - 317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Arlt, J. Vorndamm, S. Muerkoster, H. Yu, W. E. Schmidt, U. R. Folsch, and H. Schafer Autocrine Production of Interleukin 1{beta} Confers Constitutive Nuclear Factor {kappa}B Activity and Chemoresistance in Pancreatic Carcinoma Cell Lines Cancer Res., February 1, 2002; 62(3): 910 - 916. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Chen, V. Castranova, and X. Shi New Insights into the Role of Nuclear Factor-{kappa}B in Cell Growth Regulation Am. J. Pathol., August 1, 2001; 159(2): 387 - 397. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
p < 0.01.)